La présence différentielle de Streptococcus pneumoniae de sérotype E entre le transport asymptomatique et les infections pneumococciques invasives reflète un modèle unique de microévolution pathogène

Streptococcus pneumoniae est un colonisateur commensal du nasopharynx humain NP qui provoque une maladie après évasion des défenses de l’hôte et dissémination Les souches pneumococciques exprimant le sérotype E nouvellement identifié proviennent de progéniteurs A antigéniquement similaires par inactivation génétique du gène O-acetyltransferase wcjE Chaque souche E contient une mutation distincte à wcjE, suggérant que les souches E ne sont pas transmises entre les hôtes malgré leur rétablissement de plusieurs patients atteints de pneumococcie Nous avons étudié si l’absence présumée de transmission du sérotype E est compatible avec son incapacité à survivre dans les NPMéthodes Plus que le transport pneumococcique, Nous avons confirmé le sérotypage des isolats avec le séquençage des allèles wcjE. Les souches de sérotype E étaient statistiquement plus susceptibles de se produire dans le sang de l’oreille moyenne, de la conjonctive et des isolats sanguins, sérotypés comme réaction de A par Quellung. , conjonctive de, L’absence d’un clone E circulant et l’apparition accrue de souches E parmi les isolats de la maladie étaye l’idée que le sérotype E survient indépendamment pendant l’infection après la mise en place initiale de l’isolat. colonisation par un progéniteur du sérotype A Les facteurs rencontrés dans le NP contribuent probablement à la rareté relative de E parmi les isolats de transport, alors que les pressions sélectives dans les tissus plus profonds favorisent l’émergence de E. Ces résultats illustrent un nouveau modèle de microévolution sérotype A, mettant en évidence l’adaptabilité des pathogènes bactériens au sein des hôtes

Streptococcus pneumoniae est une cause globale de maladie qui comprend la pneumonie, l’otite moyenne, la conjonctivite, la septicémie et la méningite bactérienne. Ces infections sont opportunistes et ne sont pas essentielles pour la transmission ou la survie à long terme des espèces bactériennes; S pneumoniae dépend de la colonisation asymptomatique continue du nasopharynx humain NP pour sa dissémination vers des hôtes supplémentaires Un facteur majeur contribuant à la transmissibilité et à la pathogénicité de S pneumoniae est sa capacité à exprimer une capsule polysaccharidique protectrice PS, qui masque les antigènes de surface opsonophagocytose médiée Les antigènes adaptatifs ciblant l’immunité des gélules peuvent réguler la clairance spécifique du type, fournir une protection contre la colonisation et avoir contribué à l’évolution des types de gélules au moins antigéniquement distincts , communément appelés sérotypes. la base de leur réactivité aux sérums de facteurs polyclonaux, bien que certains sérotypes aient récemment été identifiés avec l’utilisation d’anticorps monoclonaux. Les anticorps monoclonaux Le sérotype A, inclus dans le vaccin anti-pneumococcique valent mais non dans un vaccin conjugué pédiatrique, est devenu prévalent. parmi les isolats de transport de NP et isolat Classiquement, le sérotype A a été défini comme étant réactif avec le sérum polyclonal Fs c, mais non réactif avec Fs b, f, et g , un profil sérologique appelé ici b-c Récemment , nous avons découvert que les isolats de la maladie b-c peuvent être divisés en sous-types antigéniquement distincts, sérotypes A et E Comparé au sérotype A, le sérotype E présente une affinité accrue pour le mAb HypAM et une affinité réduite pour le mAb HypAM. L’affinité mAb entre ces sérotypes est attribuée à l’inactivation de la capsule O-acétyltransférase wcjE dans E et la perte résultante d’O-acétylation sur carbone de β-galactose dans l’unité récurrente capsulaire PS, qui est une modification présente sur le Une PS capsulaire Au moins des allèles fonctionnellement putatifs de wcjE ont été identifiés parmi les isolats cliniques A, avec le prototype de chaque allèle trouvé dans les séquences GenBank GU et CR

Figure Vue largeDownload slideDeux isolats polysaccharide exprime qui inhibe compétitivement les deux anticorps monoclonaux Dilutions de plis en série de l’axe des lysats d’un isolat ont été examinés pour l’inhibition de la liaison hypAM à E PS ou HypAM se liant à A PS Inhibition de la liaison est enregistrée sur l’axe des y le pourcentage de signal de densité optique à nm DO par rapport au témoin négatif, où% signal ne signifie aucune inhibition Les courbes d’inhibition représentent la moyenne des échantillons dupliqués Les courbes noires d’inhibition de référence sont représentées pour les lysats de MNZ A diamant blanc et MNZ E cercle noir A, Courbes d’inhibition des lysats initiaux du carré blanc MNZ et du triangle gris MNZ B, Courbes d’inhibition des sous-clones MNZ MNZ-A triangle gris et triangle blanc MNZ-C C, courbes d’inhibition des sous-clones MNZ séparés carrés noirs, blancs et gris Abréviation: mAb, anticorps monoclonalFigure View largeTélécharger la lameTwo isole le polysaccharide express qui inhibe de manière compétitive les deux monoclonaux anticorps Des dilutions de plis en série de l’axe des lysats d’un isolat ont été examinées pour l’inhibition de la liaison de HypAM à E PS ou HypAM se liant à A PS L’inhibition de la liaison est enregistrée sur l’axe des y comme le pourcentage de signal pour la densité optique contrôle négatif, où% signal signifie pas d’inhibition Les courbes d’inhibition représentent la moyenne des échantillons dupliqués. Les courbes noires d’inhibition sont indiquées pour les lysats de MNZ A diamant blanc et MNZ E cercle noir A, courbes d’inhibition pour les lysats initiaux du carré blanc MNZ et MNZ gris triangle B, courbes d’inhibition des sous-clichés MNZ MNZ-A triangle gris et MNZ-C triangle blanc C, courbes d’inhibition des sous-clones MNZ séparés carrés noirs, blancs et gris Abréviation: mAb, anticorps monoclonal Plusieurs isolats cliniques contiennent des antécédents génomiques similaires, c.-à-d. séquence type et partage identique allèles wcjE [,,] Ceci est une preuve évidente que les bactéries exprimant le sérotype A sont liés clonalement et t En revanche, tous les isolats E examinés contiennent une mutation unique et non liée à wcjE , indiquant que chaque souche a évolué indépendamment d’un progéniteur A. L’identification répétée du sérotype E parmi les isolats de maladie invasive suggère que l’inactivation de l’enzyme peut être bénéfique pour les pneumocoques. l’analyse génétique d’isolats multiples n’a pas pu confirmer la transmission d’un seul clone E entre plusieurs hôtes Ainsi, nous avons émis l’hypothèse que les souches E se développent seulement après la propagation d’un progéniteur A à des sites normalement stériles. Pour étudier directement cette hypothèse, nous avons analysé des isolats pneumococciques b-c provenant du NP, de l’EM, de la conjonctive et du sang de populations géographiquement distinctes pour l’expression du sérotype E, probablement en raison d’une diminution de la capacité de E à survivre.

Méthodes

Collection d’isolats pneumococciques

Nous avons recueilli des isolats cliniques qui ont été recueillies auprès d’enfants dans des études de colonisation ou de maladie invasive à Boston entre et de ces isolats, ont été cultivés à partir du sang des enfants bactériémiques & lt; Les prélèvements par écouvillonnage naso-pharyngé ont été effectués sur des enfants du Massachusetts dans le cadre d’études transversales portant sur le portage du pneumocoque, , et, comme décrit ailleurs Des isolats supplémentaires ont été collectés chez des patients du Centre Médical de l’Université de Soroka Beer-Sheva, en Israël et des études cliniques dans la communauté entre et: des isolats sanguins, des cas d’épanchement conjonctive, et à partir de prélèvements NP de porteurs asymptomatiques Tous les isolats ont été typés b-c en utilisant la réaction de Quellung et ont été identifiés et codés avant d’être envoyés à l’Université de l’Alabama à Birmingham pour des études avec mAbs

Sérotypage des isolats pneumococciques avec mAbs

Nous avons utilisé l’inhibition immuno-enzymatique avec des mAb murins pour typer tous les isolats b-c, comme décrit ailleurs Nous avons co-incubé des lysats issus de cultures de bactéries avec mAb HypAM dans des plaques enduites de PS ou avec mAb HypAM dans des plaques enduites de PS Après lavage, nous avons utilisé des anticorps anti-immunoglobulines anti-souris conjugués à la phosphatase alcaline pour détecter les anticorps liés et avons enregistré la densité optique à chaque nm. Nous avons testé des dilutions successives de lysats en double et les avons classés Si les isolats ont inhibé HypAM et HypAM, ils ont été sous-clonés, et nous avons analysé chaque clone indépendamment pour l’inhibition des mAb Nous avons typé les isolats comme A s’ils inhibaient seulement HypAM et non HypAM Figure Inversement, si les isolats inhibaient HypAM et affichaient non ou réduit HypAM inhibition par rapport aux isolats A, ils ont été typés comme E

Analyse de séquence de wcjE

Les amorces utilisées pour l’amplification par amplification en chaîne par polymérase et le séquençage sont listées dans le tableau Nous avons comparé et classé les séquences selon les numéros d’accession des allèles wcjE précédemment publiés CR et GU, chacun des qui code un produit de gène putativement fonctionnel Toutes les paires de bases bp ont été numérotées en fonction de leur position dans le gène wcjE respectif, la première étant dans le gène marqué bp

Tableau Amorces utilisées pour allélique Analyse des WCJE Primer Séquence But Forward ACCTTTGATTTGCTTCATTATGG séquençage WCJE ATTGTAATGGGGGCATTTTG séquençage WCJE CTTGCTGGTGCTTCTGTGAG séquençage WCJE AACGCCGCTACTGTCGTTAT ISSpn séquençage CTTCACGTTGTTGTTGGGATTG séquençage WCJE séquençage inverse TTAGCGATCGAACCTGATCC WCJE Primaire séquence But Forward ACCTTTGATTTGCTTCATTATGG séquençage WCJE séquençage ATTGTAATGGGGGCATTTTG WCJE séquençage CTTGCTGGTGCTTCTGTGAG WCJE séquençage AACGCCGCTACTGTCGTTAT ISSpn CTTCACGTTGTTGTTGGGATTG séquençage WCJE Reverse TTAGCGATCGAACCTGATCC wcjE séquençage Agrandir l’image

L’analyse des données

Nous avons calculé un odds ratio pour comparer la probabilité d’un isolat b-c contenant E survenant à chaque site de la maladie avec la probabilité d’un isolat b-c contenant E apparaissant dans le NP Nous avons également calculé le pourcentage d’intervalle de confiance CI

RÉSULTATS

Distribution des sérotypes parmi les isolats provenant de différents sites anatomiques

Parmi les isolats sanguins qui ont été typés b-c, Boston et Israël ont été sérotypés comme A et les isolats Boston ont été sérotypés sans ambiguïté comme E. Les autres isolats sanguins israéliens, MNZ et MNZ, inhibaient HypAM et HypAM mAb Figure A, similaire à un précédent rapporté Isolat – contenant les souches A et E exprimant MNZ et MNZ, respectivement Pour étudier la présence des deux sérotypes, nous avons obtenu différents sous-clones des isolats. L’analyse Fs indiquait que tous les sous-clones étaient b-c. Figure B Le clone MNZ-A inhibait HypAM mais pas HypAM et était typé A Cependant, le clone MNZ-C inhibait les deux mAbs et ne pouvait être typé sans ambiguïté A ou E Similaire à MNZ-C, tous les sous-clones individuels de MNZ inhibaient à la fois HypAM et HypAM Figure C L’analyse du séquençage de la MNZ et de la MZN-C a révélé que les deux souches contenaient des mutations distinctes dans la région de wcjE qui affectent l’expression du gène, la caractéristique génétique de l’E. sérotype Par conséquent, pour l’analyse dans cette étude, nous avons conclu qu’un total d’isolats de sang, y compris le MNZ et MNZ, contenait des bactéries qui expriment E capsule Figure

Figure Vue largeDownload slideOccurrence de serotype perturbé par le site anatomique de l’isolement Les rapports de cotes représentent la proportion de E: A par rapport à la proportion équivalente d’isolats nasopharyngésFigure View largeTélécharger slideOccurrence de serotype perturbé par le site anatomique de l’isolement Les rapports de cotes représentent la proportion de E: A comparé à une proportion équivalente d’isolats nasopharyngiensNous avons typé b-c NP isole les isolats de Boston et Israël comme A, alors que nous avons typé les isolats NP d’Israël comme E Figure Nous avons typé b-c isolats du ME comme A et comme E Figure Nous avons typé isolats de conjonctivite L’analyse de séquençage de Figure A a confirmé des mutations à wcjE dans tous les isolats E Ainsi, les rapports de E à A parmi les isolats de sang:, ME: et conjonctiva: étaient significativement plus élevés que le ratio de E à A parmi les isolats NP rapport, [% CI, -]; [% CI, -]; et [% CI, -], respectivement; Figure

Analyse de séquence de wcjE

Pour confirmer le typage de divers isolats comme E, nous avons séquencé la séquence wcjE de toutes les souches exprimant le sérotype E et les avons comparées avec les allèles de souches exprimant le sérotype A. Toutes les séquences ont été déposées dans les numéros d’accès GenBank JN-JN et sont résumées dans le tableau Comme prévu, les souches A MNZ, MNZ, MNZ-A et MNZ contenaient chacune un gène wcjE intact. Les allèles wcjE MNZ et MNZ étaient tous les deux identiques à la plupart des séquences de gènes wcjE précédemment rapportées [,,] En revanche, MNZ-A et MNZ contenait chacun un allèle wcjE identique à la séquence du gène rapportée par Bentley et al

Tableau récapitulatif de toutes les souches E et des souches représentatives identifiées dans cette étude Site d’isolement Profil génétique sérologique Strain Géographie Anatomique HypAM HypAM Sérotype wcjE Alleleb wcjE Mutationc MNZ Boston Sang – E GU Duplication de la paire de base bp -TA- entraînant un arrêt prématuré codon à -TGA- MNZ Boston Sang – A GU … MNZ Boston Sang – E GU Insertion d’ISSpn entraînant la répétition directe de la séquence bp -TTCAC- MNZ Israël Nasopharynx – A CR … MNZ Israël Nasopharynx – E CR Duplication de bp – CCCACTCGATAC- et deletion de bp -TA- MNZ Israël Nasopharynx – E GU Duplication de bp -T, aboutissant à un codon stop prématuré à bp -TGA- MNZ Israël Blood E CR Insertion de ISr en amont de wcjE entraînant une répétition directe du bp séquence – AGAAGATT – MNZ-A Israël Sang – A CR … MNZ-C Israël Sang E CR bp -C :: T mutation non-sens MNZ Israël Oreille moyenne – E CR Insertion d’ISSpn entraînant la répétition directe de la séquence bp – GTTAG – MNZ Israël Oreille moyenne – E – Suppression de bp -, y compris suppression complète de wcjE MNZ Israël Conjonctiva – A GU … MNZ Israël Conjonctive – E GU Délétion de bp -T entraînant un arrêt prématuré du codon à bp -TAG- Site d’isolement Profil génétique sérologique Souche Géographique Anatomique HypAM HypAM Sérotype wcjE Alleleb wcjE Mutationc MNZ Boston Sang – E GU Duplication de la paire de base bp -TA- entraînant un arrêt prématuré du codon à -TGA- MNZ Boston Blood – A GU … MNZ Boston Blood – E GU Insertion d’ISSpn entraînant la répétition directe de la séquence bp -TTCAC- MNZ Israël Nasopharynx – A CR … MNZ Israël Nasopharynx – E CR Duplication de bp -CCCACTCGATAC- et délétion de bp -TA- MNZ Israël Nasopharynx – E GU Duplication de bp -T, entraînant une stature prématurée codon op à bp -TGA- MNZ Israël Blood E CR Insertion de ISr en amont de wcjE entraînant une répétition directe de la séquence bp – AGAAGATT – MNZ-A Israël Sang – A CR … MNZ-C Israël Sang E CR bp -C :: T mutation non-sens MNZ Israël Oreille moyenne – E CR Insertion d’ISSpn entraînant la répétition directe de la séquence bp -GTTAG- MNZ Israël Oreille moyenne – E – Suppression de bp -, incluant la suppression complète de La suppression de bp -T aboutissant à un codon stop prématuré à bp -TAG- Les souches du sérotype A contiennent des allèles wcjE intacts, et leurs rangées respectives ont été laissées en blancLes signes plus indiquent la capacité à inhiber l’anticorps monoclonal; Les allèles wcjE classifiés sont basés sur une homologie de séquence avec des séquences de wcjE publiées antérieurement dans des références ie, GU ou ie, CRcLocation de mutations décrites selon des nucléotides dans une séquence de gènes, où le premier nucléotide du codon de départ wcjE est un nucléotide View LargeEach E wcjE séquence contenait une mutation distincte Malgré la présence de différentes mutations, les séquences wcjE de MNZ, MNZ, MNZ et MNZ présentaient une homologie évidente avec l’allèle MNZ, alors que les séquences de MNZ, MNZ, MNZ-C et MNZ montraient une évidence homologie avec l’allèle wcjE du MNZ La séquence MNZ contenait une deletion de la région enjambant bp en amont à bp en aval du codon de départ putatif wcjE et, par conséquent, ne pouvait pas être attribuée au groupe d’allèle wcjE des séquences wcjE, contenait des codons d’arrêt prématurés: la séquence MNZ-C contenait une mutation non-sens bp C :: T; la séquence MNZ contenait une duplication de bp-TA- résultant en un codon d’arrêt prématuré à bp-TGA-; la séquence MNZ contenait une duplication de thymine à bp résultant en un codon d’arrêt prématuré à bp-TGA-; et la séquence MNZ contenait une délétion d’un résidu thymine à pb entraînant un codon d’arrêt prématuré à bp-TAG-des séquences E wcjE, les éléments transposables contenus MNZ et MNZ contenaient l’élément transposable ISSpn inséré à bp et bp, respectivement MNZ contenu l’élément transposable ISr inséré bp en amont du codon de départ wcjE Cette dernière mutation est unique en ce qu’elle n’est pas contenue dans le gène wcjE Comme wcjE est le dernier gène de l’opéron de synthèse de capsule A, nous prédisons que l’insertion amont affecte la transcription ou traduction de l’ARN de wcjE dans MNZ Il convient de noter qu’aucune des séquences de serotype A ou E précédemment rapportées [, -] ne contient ISr insérée dans la région putative non traduite directement en amont de la séquence wcjE de la souche E finale, MNZ, contient mutations Le premier est une duplication de bp -CCCACTCGATAC- La deuxième mutation est la suppression du dinucléotide -TA- Soit seule mutation entraînerait une prématurité e arrêt du codon à -TAA- ou -TAG-, de sorte qu’il n’est pas clair quelle mutation à l’origine a servi de médiateur au séroswitch de A à E

DISCUSSION

la probabilité d’identifier le sérotype E parmi les isolats sanguins par rapport aux isolats de la chariots n’est pas une indication de l’envahissement accru d’un clone transmissible, comme on pourrait le conclure en utilisant des rubriques proposées dans des études précédentes . Certains isolats de sang hébergent des sous-populations exprimant soit le sérotype A ou E et isolent MNZ de cette étude, indiquant que la conversion du sérotype de la population bactérienne infectante était incomplète. Une possibilité tentante est que l’échantillonnage de cette infection est survenu pendant la transition de la conversion du sérotype, suggérant que l’avantage de survie offert par le sérotype E pourrait être spécifique au sang. Ceci est confirmé par le fait que les sérotypes A et E peuvent être maintenus de manière stable pendant une longue période in vitro. groupes acétyles cibles de PS , perte de l’O-acétyl PS associé à wcjE Les structures médiées par wcjE peuvent également fournir des cibles pour des facteurs immunitaires innés rencontrés lors d’infections systémiques. Par exemple, le PS de différentes capsules pneumococciques. types diffèrent dans leur capacité à se lier à une lectine de type C exprimée sur les macrophages de la zone marginale dans la rate, SIGN-R , qui est une interaction importante dans la résistance à la septicémie pneumococcique Cependant, isolats, nous concluons que la conversion de A à E peut également se produire dans le NP Pourtant, E reste rare dans le NP, suggérant que wcjE fournit A des avantages de survie dans le NP Le type de capsule E a plusieurs substitutions O-acétate supposées médiatisées par d’autres gènes de la capsule O-acétyltransférase , et de nombreux types de capsules pneumococciques transportés dans le NP n’ont pas de groupes O-acétyle, ce qui révèle que O-acétylation de Cependant, le produit du gène wcjE peut être capable d’augmenter la survie de plusieurs manières différentes. Par exemple, les effets structuraux médiés par le wcjE peuvent aider les pneumocoques à adhérer aux cellules épithéliales du NP ou à augmenter la résistance au pneumocoque. Il serait intéressant de tester l’effet de wcjE sur la résistance des pneumocoques au lysozyme, car il a été démontré qu’un gène de type wcjE, adr, modifie le peptidoglycane par O-acétylation, Ainsi, on ne sait pas encore comment wcjE apporte des avantages ou des inconvénients de survie dans différentes niches hôtes, il est à noter que wcjE a été annoté dans les cps des serotypes pneumococciques serotypes V, A, D, F, F, A, A, C, A et F Parmi ces sérotypes, le sérotype V semble modifier son PS capsulaire exactement comme le sérotype A: Serotype V a un partenaire sérotype, A, qui provient de progéniteurs V par inactivation wcjE, et chaque souche A a une mutation unique à wcjE tout comme les isolats E Les sérotypes B et C pneumococciques peuvent présenter une situation similaire Les deux cps loci contiennent un allèle du type wcjE- comme le gène, wciZ, qui est fonctionnel dans B mais non fonctionnel dans C Le changement fonctionnel se produit parce que wciZ a une courte répétition TA en tandem qui peut être glissée-brin mésapporté En outre, d’autres espèces bactériennes ont des gènes similaires à wcjE Les gènes oafA de Salmonella typhimurium et Haemophilus influenzae sont homologues à wcjE et codent pour des O-acétyl-transférases qui ciblent leurs lipopolysaccharides respectifs L’expression de l’oafA dans H influenza est variable en phase et influence la résistance à la destruction par le sérum humain Peut-être que wcjE et de nombreux gènes de type wcjE jouent un rôle important dans la microévolution de S pneumoniae et d’autres bactéries, en modifiant les polysaccharides de surface pour mieux exploiter diff Nous avons découvert que la structure de la capsule de S pneumoniae subit une microévolution au cours de la progression du transport à l’infection de fluides stériles dans des niches d’hôte, comme les études NP et BloodPrevious ont associé les différents niveaux d’expression globale de capsule avec l’invasion pneumococcique de NP à un tissu plus profond. Cependant, comme le pneumocoque envahit différentes niches de l’hôte, son adaptation peut ne pas se limiter aux changements de la capsule mais peut aussi impliquer de nombreux autres gènes. En effet, les génomes des populations de streptocoques du groupe A La recherche future devrait prendre en considération l’association entre la microévolution bactérienne et la progression de la maladie, de sorte que les interventions peuvent être mieux adaptées pour protéger contre l’adaptabilité sous-estimée de ces pathoge hémostase. ns

Remarques

Aide financière

Ce travail a été soutenu par l’Institut national de l’allergie et des maladies infectieuses à la National Institutes of Health subventions R-AI à MH N, F-AI à J J C, et R-AI à J Finkelstein [chercheur principal]; et une subvention intitulée «Surveillance accrue des maladies transmissibles sexuellement chez les enfants du Massachusetts», Protocole n ° X de Wyeth / Pfizer à S I P

Conflits d’intérêts potentiels

L’Université de l’Alabama à Birmingham a des droits de propriété intellectuelle pour certains des réactifs utilisés dans cette étude, et MHN et JJC sont des employés de l’université. Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits potentiels d’intérêts que les éditeurs considèrent pertinents. le contenu du manuscrit a été divulgué